The secrets of DNA (part 1)

What do we know about DNA? A lot, but not everything yet. I am a biologist and DNA has been my Polar Star during the last 10 years (moving from Italy to Scandinavia I definitely traveled north…). Believe me when I say that we really learnt a lot about DNA since 1953, the year when Watson and Crick discovered the double helix. Still, 65 years later, many of its features remain obscure and scientists are struggling with.

How am I gonna tell you everything about DNA in this post, if it is difficult to fit all the information in one, heavy book? To make it easier and lighter, in this post I will focus only on how DNA is stored in the cell, while I will leave to other posts what happens onto the DNA.

If you want to have an overview of the DNA for beginners and without scientific vocabulary, you can find it here.

So, let’s start from scratch. DNA is constituted by nucleotides, in the same way a chain is constituted by rings. The human genome is composed by 6.4 billion rings, but because DNA has a double helix structure in which a ring of a chain is always coupled to a ring of another chain, it is habit to say that DNA is formed by 3.2 billion nucleotide (or base) pairs. How does the two chains coupling occur? Rings that form the DNA chain are of four different kinds, called: adenine (A), thymine (T), cytosine (C) and guanine (G). They couple following one specific rule: A pairs with T and C pairs with G. Because of this feature, it is said that DNA double helix is formed by two anti-parallel strands. This is an example:

AATCGCTAGCACTCGATCGAAGGGCTCAG

TTAGCGATCGTGAGCTAGCTTCCCGAGTC

Now let’s move on to the next level. How is DNA stored in the cell? DNA is kept in the safest place: the nucleus of the cell. Here comes one of the most impressive information in cell biology. How can the nucleus, which in a mammalian cell has a diameter of 6 µm, contain all the DNA and still have a lot of free space? If we stretch and line up the 23 pairs of chromosomes that constitute the human genome, we would obtain a 2-meters-long double helix. Imagine to fit in a hand-luggage a 16.000 km-long (10.300 miles) twine. Pretty tough, isn’t it? Therefore, it becomes obvious that DNA has to be stored in some special way, to fit in the nucleus. Indeed, several levels of folding are required. The first step exploits some cylindrical protein complexes, called histones. These cylinders locate with a precise frequency along the whole DNA molecules, and DNA wraps around them for approximately 1.5 times. Histones wrapped with DNA are called “nucleosomes”. This mechanism reduces DNA length of approximately 7-fold, but still it is not enough. With little imagination, scientist called the next packaging step “30 nm fiber”, as the following DNA structure has a 30 nm diameter. It is unclear how this step is achieved, but likely several proteins contribute to this shorten-and-thicken step. Next step requires looping of these 30 nm fibers, and a final condensation step leads to the fully packed chromosome. Finally, we managed to fit our twine in the hand-luggage, and we are ready to fly.

Well, we passed the check-in, but before departure, I would still like to tell you a couple of things about DNA packaging. I guess you think that what I described is just the process needed to fit DNA in the nucleus – and I wrote nothing to mean anything else – but that is not fully true. Sure, packaging is the main practical issue, but the cell has also other things going on, beyond preparing the luggage. DNA is not an entity that can be just stored. DNA is the brain of the cell, and it need to be constantly consulted (maybe this doesn’t happen to each person, but it does for every cell). The full packaging of DNA occurs only few moments before cells divides to generate two copies of itself, otherwise the situation is more flexible. Usually, there are DNA regions that are packed, while others are open and accessible because they contain information needed by the cell. Depending on the stimuli that the cell receives, some regions are made accessible and other isolated, and this changing status can be very quick. How is this achieved? Through different ways, and I will mention the main ones. Histones can be decorated with some appendixes called “post-translational modifications” that make DNA more or less accessible, depending on the kind of appendix and its position on the histone complex. Moreover, specific proteins can separate whole regions of DNA from the neighboring ones. A factor called CTCF recognizes a specific sequence of DNA (that can be found in many different places of the chromosomes) and binds to it. A protein complex called cohesin has a ring structure that can trap linear DNA, or extrude DNA loops (imagine to fold in half a wire and pass it through a ring). Cohesin can slide along the double helix, freely or pushed by other proteins, but it stops when it encounters CTCF. In this way, DNA loops formed by cohesin are stabilized and isolated from the neighboring regions. Of course, following adequate stimuli, these loops can be freed or permanently maintained. Below you can see a picture that shows the loop formation.

Picture1

Cohesin is represented by the blue rings, while purple squares represent CTCF. Are you wondering what the red squares are? And maybe what the small arrows refer to? We will see it in the next post, together with the importance of these loops for transcription and other crucial cellular processes.

Don’t forget to share the post if you liked it!

2 Comments

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s